Genetics DNA...

Description

New solution updates


Question

1) Fifteen Neurospora mutants were isolated that are unable to grow in the absence of cysteine. The pathway
for the synthesis of this amino acid is as follows
5-methyltetrahydropteroyltri-L-glutamate
methionine
S-adenosyl-L-methionine
S-adenosyl-L-homocysteine
homocysteine
crystathionine
cysteine
The mutants were divided into 6 groups based on complementation tests: cys-1, cys-2, cys-3, cys-4, cys-5 and
cys-6. A member of each was tested for its ability to grow on minimal media supplemented with a compound
in the synthetic pathway with the following results.
MM + SMinimal
MM + SMM +
MM +
adenoysl-LMM +
MM +
Mutant media
adenosyl-Lcysteine methionine
homocystei homocysteine cystathionine
(MM)
methionine
ne
no
cys-1
growth
growth
growth
growth
growth
growth
growth
no
cys-2
growth
no growth
no growth
no growth
no growth
no growth
growth
no
cys-3
growth
no growth
growth
growth
growth
growth
growth
no
cys-4
growth
no growth
no growth
no growth
growth
growth
growth
no
cys-5
growth
no growth
no growth
growth
growth
growth
growth
no
cys-6
growth
no growth
no growth
no growth
no growth
growth
growth
On the diagram above identify the step that requires the wild-type gene corresponding to the mutants cys-1
through 6.
2. A lab class repeated the experiments of Yanovsky and generated hundreds of mutations in the trpA gene
with EMS which causes base substitution mutants. The sequenced each of the mutants and found that three
(57, 92, 98) resulted in a change in the same amino acid of the protein at position 234. The DNA sequences of
the region containing the mutations are below
wild-type
CAAAGGCATTGATGAGTTTT
57
CAAAGGCCTTGATGAGTTTT
92
CAAAGGCATGGATGAGTTTT
98
CAAAGGCGTTGATGAGTTTT
(a) What the sequence of this region in wild-type and the three mutants? Highlight the amino acid changed in
the wild-type and the one it is changed to in the mutants.
(b) If Yanovsky had obtained these mutations would he have been able to extend conclusions he made about
the genetic code?
(c) When the students in the lab class tried to repeat the experiment of crossing two mutants together to
generate a recombinant that is wild-type, they were successful after crossing two pairs, but not with the other
pair. Which pair was unsuccessful and why?
3) Several new mutations in the rIIB gene of phage T4 were generated with proflavin. The sequence of four
mutants is shown below along with the wild-type, only part of the sequence is shown, the first base shown in
the wild-type is in frame.
Wild-type
GATGCAGTTATTGCTCCAGTTGCTAAATCTGACATTATT
M15
GATGCACAGTTATTGCTCCAGTTGCTAAATCTGACATTATT
M77
GATGCAGTTATTGCTCCAGTTGCTAAATCTCATTATT
G66
GATGCAGTTATTGCTCCAGTTGCTAAATCTGACGATTATT
G90
GATGCAGTTATTGCCCAGTTGCTAAATCTGACATTATT
G122
GATGCACCTATTGCTCCAGTTGCTAAATCTGACATTATT
(a) Identify the changes in nucleotide sequence in each of the mutants. Is each of these what is expected with
proflavin mutagenesis?
(b) If the mutants were crossed to each other, which ones could yield recombinants with wild-type phenotype
and grow on E. coli strain K12?
(c) What is the sequence of the region shown in wild-type, what could the sequence of this region of the
protein be in the wild-type recombinants?
(d) Why might the recombinants you identified in (b) not be wild-type? Which of these recombinants is most
likely not to be wild-type?
4) Different temperature sensitive mutants of E. coli in genes encoding proteins involved in transcription were
grown at the permissive temperature for several generations and while still actively growing the temperature
was raised to the restrictive temperature. After raising temperature, the synthesis of new RNA was assessed
using radioactively labeled nucleotides. Assume the mutations completely inactivate the proteins at the
restrictive temperature and that function of the mutant protein was abolished instantly temperature was raised.
What would happen to the level of new RNA synthesized in the following mutants after raising the
temperature? Explain your answers.
(4 points each)
(a) Sigma factor
(b) Subunit of RNA polymerase
(c) Rho protein
5) Below is the sequence of an mRNA
GAUAUAUGCGCGAUGGGUGAAAACGAGACUAUUUGCUCGAUUUCAGAGGCAUCCUAUUAAUGACGGUAAUUAAAGCGCAAAAAAAAAAA
(a) Was this isolated from a eukaryote or a prokaryote?
(b) What was the sequence of the template strand in the genomic DNA used to synthesize this molecule.
Write the sequence as is conventional for a single stranded DNA strand.
(c) What is the sequence of the protein translated from this mRNA?

 

Solution ID:350813 | This paper was updated on 26-Nov-2015

Price : $40
SiteLock